Human variation

High Altitude:

High altitudes have an obvious connection with cold temperatures and thin air. High altitudes cause a decrease in air pressure, which disturbs the homeostatsis by minimizing the amount of oxygen being released through our vascular system.  Symptoms such as fatigue, nausea, and hemorrhaging in the lungs are a direct result of the change in air pressure. And in serious cases can cause death.  Hypoxia is the biggest problem related to high altitudes exclusively.  Being so high up, our bodies aren't used to that kind of pressure so naturally we struggle in that kind of environment, however that hasn't stopped people from climbing mountains and using high altitudes to train their body to a new level.

A short term adaptation to high altitude by humans would be a change in breathing methods, change in amount  breathes, increased pulse rate , and increased blood pressure due to the low levels of oxygen circulating throughout the body.
A facultative adaptation to high altitude by humans is the body's increase of it its production of red blood cells and capillaries to carry more oxygen through the body and create carbon dioxide. As a direct result our lungs increase in size from the production of oxygen.
A developmental adaptation to high altitude by humans is having greater lung and heart capacities.The EPAS1 and PDP2 gene was evolved over time in response to low oxygen levels from high altitudes, which also helps the body burn food as fuel for the body.
A cultural adaptation to high altitude by humans  would be the mere existence of thriving civilizations in high altitudes and very high altitudes. Places like Colorado or Tibet. Along with the people that actually live and endure these conditions everyday there are also athletes who use high elevation and altitudes to train their bodies in harsher conditions to strengthen them inside and out. 

It is beneficial to study human variation from this perspective because of the mere beneficial information of each environment and stresses. In order to thrive and evolve we must father data and use that to increase our chances of survival. For example if a person living in Southern California there whole life were to move to Colorado, they would need to know what to expect living there and if there body can take it. 

I wouldn't use race to understand the variation of adaptations because it has no direct correlation. Race is a product of our environment, i.e. sun exposure or lack there of, flat/rough ground/, and son on, so it would not make sense to make sense of the adaptations to any environmental stress a result of race. Although one would be able to see how constant exposure to an environmental stress shapes a culture in both existence of living and body characteristics. The study of environmental influences on adaption is a better way to understand human variation because the environment effects all people differently and doesn't rely on a persons race as the reason for change.

Communication Experiments

1. This experiment really relies not only on your ability to communicate differently but also on the person in which you are communicating with. You could do your absolute best trying to get a message across but fail because of your partners lack of knowledge regarding different aspects of communication. With that being said, the person i choose to conduct this experiment with is a friend a mine who knows me quite well as i know him ,along with our similar knowledge of common body movements that help resemble and understand the conversation. What i mean by that, is if for example if my friend asked me whether i was staying or leaving, if i simply chucked up the peace sign, he would understand and be aware that i was leaving without saying a word. Although it was tricky and at times we struggled getting through parts of the conversation, for the most part keeping the conversation simple helps limiting elaborating answers. I let him know ahead of time the reason for my silence so we were both aware how we were going to go about “talking”. However i think it would have been much more of a challenge if i didn't include him in. 

My partner was absolutely in control of the conversation the entire time, so its safe to say he had the power in the conversation. However if you think about it, my lack of communication skills at the time limited the conversation and his responses so in a way, maybe i was in control, (paradox). He was in charge from start to finish because i couldn't really bring anything up unless i just pointed out something random to change the topic. I think with more people, my voice, or lack their off, would have been drowned out because there would be too much going on for me to catch up, or have the other people wait for me. However that is affected by the groups prior knowledge of the experiment whether or not I'm excluded more.

The stand out answer would obviously be the culture with spoken language because of the simple fact that they have more options and better capability to expressing complex ideals. You can say that you wouldn't know which culture communicates complex ideas in their community better till you experience it first hand. The speaking culture might look down upon cultures without it or might look at them as less evolved.Probably the way most people of any speaking culture look at indigenous tribes or people that are deaf/blind.

2. So for this experiment i had to constantly check myself to speak in the same manner without showing any emotion with my body movements or changing the pitch of my voice to get my message across. My partner was laughing most of the time as he was trying to decipher my monotone voice but had an easier time than the previous experiment. I would say it was easier however it was a different kind of challenge for both of us because of the lack of pizzaz in the delivery. He did have some difficulty understanding me however he didn’t respond to my lack of body language.

This experiment shows how important signs are in language and everyday communication and how big of a difference or challenge it makes it without them. Body language and different pitches along with a number of factors in communication as a whole tell the person you're talking to more than what you’re just saying with words. Whether they feel comfortable, awkward, or even if they are lying.

The ability to read a person body language, both men and women, is beneficial in different aspects of your life. It can help you figure out how a conversation is going with a significant other or boss, and in more radical examples, the difference between seeing the guy reach for his gun and getting killed. The ability to read body language is something grown with a lot of contact and knowledge of the general publics communication techniques. 

I think people who aren't confident in themselves or with low self esteem that don't talk to a lot of people or it could just be people who are completely oblivious to common quirks that they miss a message. The only situation i could think of is when someone is faking some sort of body language to trick you.

Piltdown Hoax

The Piltdown hoax  started in the early 1900's when a laborer digging at Barkham Manor near the village of Piltdown discovered what appeared to be a piece of a human skull. He reported his findings to Charles Dawson and he went on and dug the area himself and eventually found more fragments of the skull. He took his findings to London's Natural History Museum where he met up with Arthur Smith Woodward. Arthur then accompanied Charles to the site where he found the fragments in the summer of 1912 and ended up finding primitive tools, and fossils. Arthur believed all the fossils and skull fragments they found were from the same species so he was able to reconstruct it. The reconstruction indicated a bigger skull meaning a bigger brain in this new found species. On December 8th, 1912 at a Geological Society Meeting the world was introduced to the Piltdown man scientifically named Eoanthropus Dawsoni. It was a big deal because at the time little was known of the species and the general connections of early apes and humans. Great Britain was also trying to make their mark and show the rest of the world they are not only a force to be reckoned with but the birthplace of life/humans and luckily the discovery of the Piltdown man helped them do that. Although there was much speculation from around the world from experts arguing that the findings were separate human and ape fossils mixed together. However further findings from Dawson & Woodward in 1913 at Piltdown and then in 1915 at a site near the original site of piltdown that they found more bones, even naming it Piltdown man II.These findings and the backing of the Natural History Museum helped silence doubters and critics for more than 40 years.

The piltdown man hoax was discovered in the 1950's but clues leading to the discovery of the hoax began in 1949 after WWII, when new technology helped date fossils more accurately. In 1949 they began to measure the fluorine content of fossils scientists could get a better date on the fossils. When the piltdown man fossils were given a fluorine test the results showed the fossils were only one hundred thousand years old, instead of the millions of years old it would expected to be given the location where it was found. But it was in 1953 when a full series of scientific tests were conducted on the piltdown fossils, which lead to the exposure of the hoax. The testing showed that staining on the bones was superficial, that some of the engraves in the bones were craved with a steel knife after it was fossilized, and the more noticeable find was the teeth using a microscope they discovered that they teeth were filed down to make them look similar to the ware of human teeth. And the jaw bone found was dated less than 100 years old and came from a female orangutan.  The discovery of the hoax put the scientific community into shock; they couldn't understand why anyone would create fake fossils. Arthur Woodward kept digging in piltdown for decades after Dawson died.

Fluorine analysis was ultimately responsible for exposing the hoax because it showed that the findings and fragments didn't have the adequate amount of fluorine in them to be as old as they were supposed to be. X-ray analysis was able to prove that the finding of the jawbone was from a orangutan.Microscopic examination of the teeth found revealed file-marks on them that showed someone had modified and/or filed the teeth to make them look like those of a human.

I do not think it is possible to remove human factors from science because it is humans themselves who do the discoveries. The same factors that can cause errors or mistakes have been the same reasons for some remarkable discoveries in the science community. They can definitely be reduced; however, they're naturally occurring things. Of course you want to eliminate or reduce any chance of error when doing a study but it is human factors that help gather crucial information. I wouldn't want to remove the human factors from science because you got to take the good with the bad and without human factors in science there would not be as many discoveries.

The lesson I took from this historical event was that inaccurate information that is not properly verified by multiple sources can create ignorance of knowledge, even potentially mess up our entire knowledge of our species existence on this planet. It’s important to be thorough in your study and in cross examining your data because wrong information is dangerous to everyone.

Homologous & Analogous Traits

Homologous Trait:

Human Arm and Owl Wing

1.
Humans or also referred to as homo sapiens, more developed of all the mammals. 
An owl is a nocturnal bird known for their big forward facing eyes and hooded beak.
Humans have a longer ulna and radius, while an owl, or birds in general have longer carpals & meta carpals.  The trait from both species exhibit differences simply because they are used for different functions/ purposes. 
Humans need a larger ulna and radius for upper body & hand/arm strength which is essential to their survival in their environment. Birds however need longer carpals and metacarpals to support their feathers and fly which is essential to their travel and eating as well.
A common ancestor of these two species would be probably a fish from prehistoric times. Its homologous because all the species that came from that ancestor have the same bones. 

Analogous Trait:

Butterfly & Chicken 

2.
Butterfly is an  insect with two pairs of large wings that are covered with tiny scales, usually brightly colored.
Butterflies and chickens both have wings however the wings are different in structure and function. 
The wings of birds have bones, muscles and feathers while the wings of butterflies are made of veins, protein and scales.
Although a chicken is a bird and has wings, it does not mean their direct function is for flying like most other birds or a butterfly in this case. 
Its analogous because of the fact that nothing in the structure of both kind of wings are similar.
I dont think a common ancestor would possess this trait.

ATGTGTTGGATTTTTAGACTGGCGTCGTGGAAGTATAGTTAG

Historical Influences

Alfred Russel Wallace

Alfred Russel Wallace, born January 8th 1823 to November 7th 1913, was a man of many talents but is more notably known for his contributions and discovery of the concept of evolution by natural selection. Although Mr. Wallace is highly touted as a brilliant mind and a trailblazer in the science community, he is often overlooked and not given enough credit for his work with Charles Darwin. Both men did not work hand to hand on their scientific theories/ experiments but were vital to each others work and progress.

What is preventing organisms from reproducing at their potential? 

-Alfred thought about specimen and humans when disputing natural selection and what keeps the numbers down but it was through his severe topical fever that caused hallucinations that he came up with the idea that he later penned to Darwin through a private letter.

Resources are limited.

-Alfred was one of the first biologists to express concern about the effects humans were having on the natural world so he was more than aware of the benefits and restrictions that resources were not only for survival but in evolution.

If the environment changes, the traits that are helpful or adaptive to that environment will be different

-Through his scientific expeditions to different continents and countries he understood the environment will either help or hurt the specimen and to each environment there are specific traits to have in order to survive and prosper.

In order for natural selection to occur, reproduction MUST occur

-It was through the theory of natural selection that Alfred came up with the concept of evolution that without reproduction, growth will stunt and is needed for life to move forward.

Individuals do not evolve. Populations do

-Through his concept of evolution, across generations Alfred was able to put both his work and Darwins work together in the sense that each other work only helped the others.

Charles Darwin would have not been able to develop his theory of natural selection without the work of his colleague Alfred Russel Wallace because they go hand in hand. Besides the fact that people, and accredited scientists already think Darwin stole the work of Wallace, Charles was unable to perfect or even make a clear concise formulation to his theory prior to Wallace sending him that letter. Would Charles have figured out it out on his own? We don't know and never will but we do know that it wasn't until Charles received Alfred's letter that he was able to make the connections. 

The attitude of the church did not affect Darwin and his eventual publication of his book On the Origin of Species that much. Darwin was conflicted with religion most of his life but he did not let that interfere with facts and his studies. He understood the importance of religion, at the time, but he wanted his work to be taken seriously because that's what it was, important ground breaking information. 

Sources: http://www.famousscientists.org/alfred-russel-wallace/

http://wallacefund.info/content/biography-wallace

http://people.wku.edu/charles.smith/wallace/BIOG.htm